counterion is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Updated 2026-01-24. Numbers and descriptions here follow the published literature rather than marketing material.
The molecule is a short, linear, hydrophilic peptide that dissolves readily in water or aqueous buffer. Its principal chemical liabilities are hydrolytic rather than oxidative, since it contains no cysteine, methionine, or tryptophan residues. The aspartate–glycine step is a recognised site for aspartimide formation under mildly acidic or basic conditions, generating isoaspartate and succinimide-related products over time. Desiccated lyophilised powder held at −20 °C is comparatively stable, whereas dilute solutions degrade faster and are best frozen as single-use aliquots rather than thawed repeatedly.
No pharmacopoeial monograph exists for this peptide, so quality rests on the supplier's internal specifications and on whatever independent testing a purchaser arranges. Certificates of analysis differ widely in which tests they report and in the limits applied. The counter-ion introduced during purification, commonly acetate or trifluoroacetate, changes the net peptide content of a given mass of powder, so two samples of equal weight may not contain equal amounts of the active sequence. Third-party laboratories can verify purity, identity, residual solvents, and counter-ion content for a fee, which makes documentation more informative than labelling.
Verification of a sample usually begins with reversed-phase high-performance liquid chromatography, which resolves the peptide from truncated sequences and other impurities and expresses purity as a percentage of total peak area. Mass spectrometry by electrospray ionisation or matrix-assisted laser desorption supplies an independent check, because the measured mass can be compared against the theoretical value for AEDG. Amino acid analysis or tandem mass spectrometry sequencing can confirm residue order. Each of these methods answers a different question: a purity figure does not establish identity, and an identity match does not establish how much of the material is intact peptide.
Freeze-dried epitalon is normally kept at minus twenty degrees Celsius in a sealed, desiccated container, protected from light. Short excursions at ambient temperature during shipping are generally tolerated, but repeated warming and cooling cycles encourage moisture uptake, which shortens shelf life. Once dissolved, the peptide is far less stable than the solid: aqueous solutions are subject to hydrolysis and to deamidation at the aspartate and glutamate residues. Working solutions are therefore held refrigerated and used within days, and repeated freezing and thawing of the same vial is best avoided.
Identity and purity are checked by reversed-phase high-performance liquid chromatography, usually with ultraviolet detection near 214 nanometres, where the peptide bond absorbs. Mass spectrometry confirms the expected mass and reveals whether truncation products or adducts are present. Acid hydrolysis followed by amino acid analysis gives the residue ratio, which should approximate one alanine, one glutamate, one aspartate and one glycine. Counter-ions such as acetate or trifluoroacetate remain in the dried product and lower net peptide content, so a stated purity figure on a label does not by itself describe how much peptide a vial holds.
| Property | Value | Notes |
|---|---|---|
| Identity confirmation | Electrospray or MALDI mass spectrometry | Observed mass compared with theoretical 390.35 Da |
| Purity specification | 95 percent or greater by RP-HPLC | Common convention for research-grade peptide |
| Counter-ion | Acetate or trifluoroacetate | Affects net peptide content of a weighed sample |
| Solution storage | −80 °C as single-use aliquots | Repeated freeze–thaw cycles accelerate loss |
| Main degradation route | Aspartimide formation at Asp-Gly | Produces isoaspartate and related species |
Storage and handling follow conventional peptide practice. Lyophilized epitalon is typically kept refrigerated or frozen, protected from moisture and light, and allowed to equilibrate to room temperature before opening to avoid condensation. Once dissolved, aqueous solutions are usually stored cold and used within a short period, since dilute peptide solutions can support microbial growth and may slowly degrade. The absence of cysteine and methionine reduces, but does not eliminate, oxidation concerns during long-term storage.
Regulatory status varies by country and is not harmonized. Epitalon is not an approved drug in major Western jurisdictions. In some countries it is sold as a research chemical, and in others it has appeared in products marketed for other categories. This inconsistent status means that purity, labeling accuracy, and documentation differ widely between suppliers, and verification of identity and purity through independent analysis is the usual way buyers assess a given lot.
Epitalon appears in the literature primarily through a small number of research groups, most of them associated with the St. Petersburg Institute of Bioregulation and Gerontology. Publications describe cell culture experiments, animal studies, and a limited number of small human studies. Independent replication outside this network is sparse. As a result, reviews of the topic usually separate descriptive reports of observed effects from the question of whether those effects generalize, and they note the difficulty of comparing studies that use different preparations and endpoints.
Identity and purity are usually assessed by reversed-phase high-performance liquid chromatography with ultraviolet detection, frequently near 214 nanometers where the peptide bond absorbs. Mass spectrometry, most often with electrospray ionization, confirms the observed molecular mass and helps separate the intact peptide from truncated or modified forms. Amino acid analysis or tandem mass spectrometry can establish residue order. Purity is commonly quoted as an area percentage, yet such values are method-dependent, and comparisons between laboratories require matching column, gradient and detection wavelength.
Laboratory handling begins with dissolution of the lyophilized powder in water or a suitable aqueous buffer. The dry solid is the more stable form, so stock solutions are generally prepared only when required and kept cold afterwards. Repeated freezing and thawing of a solution is avoided because it encourages aggregation and gradual loss of the intact chain. Diluents and containers are selected to limit adsorption of a short peptide onto plastic surfaces and to reduce microbial growth in aqueous preparations.
Stability depends strongly on pH, temperature and the presence of oxygen and trace metals. Cleavage of the backbone proceeds faster under neutral to alkaline conditions, whereas acidic solutions tend to slow that reaction. The aspartate and glutamate side chains can undergo deamidation or imide formation over time, generating closely related impurities. Published stability data specific to epitalon are sparse, so the usable life of a given solution is best regarded as an open question that depends on buffer composition, concentration and storage temperature.
Identity is normally established by reversed-phase high-performance liquid chromatography combined with mass spectrometry, a pairing that separates components and confirms molecular mass at once. Purity is quoted as a percentage from the chromatogram, and figures above ninety-five percent are a frequent commercial specification. Amino acid analysis or sequencing supplies further confirmation when required. Because many short peptides behave similarly under chromatography, retention time alone does not establish sequence; the mass measurement is what separates one tetrapeptide from another, and certificates should report both.
Short peptides such as AEDG are normally supplied as a freeze-dried solid and are kept dry, cold, and shielded from light. Holding at minus twenty degrees Celsius is common for the long term, while a refrigerator suffices for brief periods before use. The material takes up moisture to some degree, so containers should stay sealed and be allowed to reach room temperature before opening, which limits condensation on the contents. Repeated warming and cooling of a single container is discouraged because it admits water and can lower the amount of intact peptide.
Reversed-phase high-performance liquid chromatography is the standard approach for assessing purity, usually with ultraviolet detection near 214 nm, where the peptide bond absorbs. Mass spectrometry, most often with electrospray ionization, confirms the molecular mass and helps reveal truncation or deletion byproducts. Amino acid analysis can verify composition, and counterion content is sometimes measured because peptides purified with trifluoroacetic acid retain variable amounts of that salt. Purity figures reported without a stated method and detection wavelength are difficult to interpret.
Material sold for research use varies widely in documented quality. A useful verification package includes a certificate of analysis that states peptide content rather than only net weight, the chromatographic method and column used, and a mass spectrum consistent with the expected mass. Independent testing by a third-party laboratory is occasionally reported. Statements of identity resting only on a supplier label provide little assurance, and the gap between nominal mass and actual peptide content can be substantial once counterions and residual water are counted.
Peptides of this size are generally stable as dry solids but degrade in solution over time. The principal routes are hydrolysis of the peptide backbone and oxidation, with hydrolysis favoured by elevated temperature and extreme pH. Aqueous solutions held at room temperature can show measurable loss of purity within days, while frozen aliquots are considerably more durable. Because the sequence contains neither cysteine nor methionine, oxidation is less of a concern than for many other peptides, but pH control during handling still matters.
== Epidemiology == A direct inguinal hernia is less common (~25–30% of inguinal hernias) and usually occurs in men over 40 years of age. Men have an 8 times higher incidence of inguinal hernia than women.
== Illicit production == Illicit production and sale of etonitazene has been limited. Identified on the Moscow illegal drug market in 1998, it was primarily smoked in laced cigarettes. A chemist at Morton Thiokol synthesized the compound for his own use. The drug was produced in Russia in 1996 and sold as 'Chinese Dwarf'. The drug resulted in an unconfirmed number of deaths due to its uncertain potency. Etonitazene appears to have a steep dose-response curve, and unpredictable pharmacokinetics especially when injected, in a similar manner to some other potent opioids such as dextromoramide, which may cause etonitazene to be especially hazardous when compared to opioids of similar potency such as fentanyl.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
In 1884, Svante Arrhenius attributed the properties of acidity to hydrogen cations (H+), later described as protons or hydrons. An Arrhenius acid is a substance that, when added to water, increases the concentration of H+ ions in the water. Chemists often write H+(aq) and refer to the hydrogen cation when describing acid–base reactions but the free hydrogen nucleus, a proton, does not exist alone in water, it exists as the hydronium ion (H3O+) or other forms (H5O2+, H9O4+). Thus, an Arrhenius acid can also be described as a substance that increases the concentration of hydronium ions when added to water. Examples include molecular substances such as hydrogen chloride and acetic acid. An Arrhenius base, on the other hand, is a substance that increases the concentration of hydroxide (OH−) ions when dissolved in water. This decreases the concentration of hydronium because the ions react to form H2O molecules:
== History == IMS was first developed primarily by Earl W. McDaniel of Georgia Institute of Technology in the 1950s and 1960s when he used drift cells with low applied electric fields to study gas phase ion mobilities and reactions. In the following decades, he integrated the recently developed technology he had been working on with a magnetic-sector mass spectrometer. During this period, others also utilized his techniques in novel and original ways. Since then, IMS cells have been included in various configurations of mass spectrometers, gas chromatographs, and high-performance liquid chromatography instruments. IMS is a method used in multiple contexts, and the breadth of applications that it can support, in addition to its capabilities, is continually being expanded.
2005: "Annual Sarkar Lecture" was established in Sarkar's honor to invite distinguished scientists to give lectures in the Research Institute of SickKids. 2006: Priyadaranjan Ray Memorial Award from the Indian Chemical Society. 2008: Visiting Professor, University of Hong Kong, Hong Kong. 2010: Fellow of IUPAC (International Union of Pure and Applied Chemistry). 2010: Fellow of the Royal Society of Chemistry, U.K. (FRSC (UK)). 2020: Sarkar Symposium, a celebration honoring Sarkar's 55 year career at SickKids. 2024: Order of Canada
=== Undercover Officer Damages === The undercover officer known as "Lizzie James" involved in the attempt to obtain evidence in the original investigation by befriending him took early retirement from the Metropolitan Police force in 1998. With the support of the Police Federation, she sued the Metropolitan Police for damages arising from the investigation claiming that the case ruined her career. In 2001, shortly before it was due to be heard, her case was settled out of court and she received £125,000. Her solicitor said: "The willingness of the Metropolitan Police to pay substantial damages must indicate their recognition that she sustained serious psychiatric injury". The payout was widely criticised by various sources, particularly as Nickell's son had been granted £22,000 (less than a fifth of the amount paid to the undercover detective) from the Criminal Injuries Compensation Authority.
Sources: en.wikipedia.org
Mass spectrometry provides the identity check, because the observed mass is compared with the theoretical mass of the AEDG sequence. Chromatography separates and quantifies impurities but does not by itself prove which peptide is present. The two techniques are normally used together.
Yes. Trifluoroacetate and acetate ions remain associated with the peptide after purification, so a weighed quantity of powder contains less peptide than the nominal mass suggests. Certificates that report net peptide content rather than raw weight are more directly comparable between suppliers.
Dilute aqueous solutions are less stable than the dry powder and are usually aliquoted and frozen to avoid repeated freeze–thaw cycles. Lyophilised material is best stored desiccated at −20 °C, protected from light. Working solutions are typically prepared fresh from a frozen aliquot.
The solid is kept cold, dry and dark, typically at minus twenty degrees Celsius, in a sealed container with desiccant. Dissolved material is kept refrigerated and used promptly. Freezing and thawing a solution repeatedly is avoided because it accelerates degradation.